If you don't remember your password, you can reset it by entering your email address and clicking the Reset Password button. You will then receive an email that contains a secure link for resetting your password
If the address matches a valid account an email will be sent to __email__ with instructions for resetting your password
1 These authors contributed equally to this study.
Kyung-Cheol Sohn
Footnotes
1 These authors contributed equally to this study.
Affiliations
Department of Dermatology and Research Institute for Medical Sciences, School of Medicine, Chungnam National University, 55 Munhwa-ro, Daejeon 301-747, Republic of Korea
1 These authors contributed equally to this study.
Ge Shi
Footnotes
1 These authors contributed equally to this study.
Affiliations
Department of Dermatology and Research Institute for Medical Sciences, School of Medicine, Chungnam National University, 55 Munhwa-ro, Daejeon 301-747, Republic of Korea
Department of Dermatology and Research Institute for Medical Sciences, School of Medicine, Chungnam National University, 55 Munhwa-ro, Daejeon 301-747, Republic of Korea
Department of Dermatology and Research Institute for Medical Sciences, School of Medicine, Chungnam National University, 55 Munhwa-ro, Daejeon 301-747, Republic of Korea
Department of Dermatology and Research Institute for Medical Sciences, School of Medicine, Chungnam National University, 55 Munhwa-ro, Daejeon 301-747, Republic of Korea
Department of Dermatology and Research Institute for Medical Sciences, School of Medicine, Chungnam National University, 55 Munhwa-ro, Daejeon 301-747, Republic of Korea
Department of Dermatology and Research Institute for Medical Sciences, School of Medicine, Chungnam National University, 55 Munhwa-ro, Daejeon 301-747, Republic of Korea
Department of Dermatology and Research Institute for Medical Sciences, School of Medicine, Chungnam National University, 55 Munhwa-ro, Daejeon 301-747, Republic of Korea
Department of Dermatology and Research Institute for Medical Sciences, School of Medicine, Chungnam National University, 55 Munhwa-ro, Daejeon 301-747, Republic of Korea
Department of Dermatology and Research Institute for Medical Sciences, School of Medicine, Chungnam National University, 55 Munhwa-ro, Daejeon 301-747, Republic of Korea
Department of Dermatology and Research Institute for Medical Sciences, School of Medicine, Chungnam National University, 55 Munhwa-ro, Daejeon 301-747, Republic of Korea
β-Catenin exerts its crucial role in hair follicle development and hair growth cycle. Although the importance of Wnt/β-catenin is well recognized, the downstream effectors of β-catenin have not been clearly elucidated yet.
Objective
The aim of this study is to identify the β-catenin-regulated genes in cultured human hair outer root sheath (ORS) cells.
Methods
We transduced ORS cells with adenovirus harboring the expression cassette for constitutive active form of β-catenin, then performed cDNA microarray.
Results
Overexpression of β-catenin led to the upregulation of hair cell differentiation markers such as keratin 16 and 17. In addition, the expression of Pitx2, a bicoid-type homeodomain transcription factor, was also increased by overexpression of β-catenin in ORS cells cultured in vitro. To investigate the potential role of Pitx2, we made the recombinant adenovirus expressing Pitx2, then transduced into the cultured ORS cells. Interestingly, Pitx2 induced the expression of keratin 16 and 17, indicating that Pitx2 activates ORS cells towards the follicular differentiation pathway preferentially.
Conclusion
Our results implicate the potential importance of Pitx2 as a β-catenin downstream modulator in hair growth control.
]. Many investigators have identified several molecules that may play an important role in the development of hair follicle. In one instance, Wnt/β-catenin signaling gained a lot of interest because of its crucial role in the hair follicle morphogenesis [
]. The Wnt signaling pathway is highly conserved in the animal kingdom, and Wnt proteins constitute a large family of secreted molecules that act as extracellular signaling factors. When Wnt ligand binds to its cognate receptor frizzled on the plasma membrane, intracellular dishevelled (Dvl) protein is activated and GSK3β is inactivated. As a consequence, the β-catenin degradation complex is inactivated, inducing the stabilization of cytoplasmic β-catenin. Upon accumulation, β-catenin interacts with Lef-1/TCF family of DNA-binding proteins to generate a functional transcription factor complex [
]. Furthermore, Lef-1 is expressed in primitive ectoderm even before the dermal condensation is formed, and epithelial Lef-1 is maintained at the growing tip of the hair germ and induced in the adjacent mesenchyme [
]. These results highlight the critical role of Wnt/β-catenin signaling in establishing the placement of follicular primordia. In accordance, mice expressing a stabilized β-catenin controlled by an epidermal promoter undergo a process resembling de novo hair follicle morphogenesis [
]. In addition, β-catenin takes over a dual role in hair follicles, functioning not only for the formation of hair placode but also for the differentiation of stem cells into hair follicle or skin in the adult. A conditional deletion of β-catenin in the skin after hair follicle formation leads to the complete loss of hair after first cycle and the formation of dermal cysts that exhibit characteristics of epidermal differentiation [
]. These results imply that β-catenin is necessary for fate decisions of stem cells to follicular keratinocytes. Besides its critical role in the morphogenesis of hair follicle, Wnt/β-catenin signaling is also implicated in anagen induction. It has been demonstrated that Wnt/β-catenin-driven β-gal activity is increased in the bulge region of the hair follicle at the onset of anagen in TOPgal transgenic mice [
]. Additional evidence shows that chronic and transient activation of β-catenin in resting hair follicles results in the changes consistent with anagen induction, indicating that Wnt-activated β-catenin signaling drives the transition from telogen follicle into actively growing stage during the hair growth cycle [
Although the importance of Wnt/β-catenin signaling in the morphogenesis and growth cycle of hair follicle is well recognized, however, the downstream effectors of β-catenin have not been clearly elucidated yet. In this study, we identified the β-catenin-regulated genes in cultured human outer root sheath (ORS) cells using adenoviral gene delivery system and cDNA microarray analysis technique, and found that β-catenin affects the differentiation of ORS cells.
2. Materials and methods
2.1 Immnohistochemistry
Scalp specimens were obtained from plastic surgery, in accordance with the ethical committee approval process of Chungnam National University Hospital. Specimens were embedded in paraffin. Sections of specimens were dewaxed, rehydrated, then washed three times with phosphate-buffered saline (PBS). After treatment with proteinase K (1 mg/ml) for 5 min at 37 °C, sections were treated with H2O2 for 10 min at room temperature, blocked in 0.1% Tween-20, 1% bovine serum albumin (BSA) in PBS for 20 min, and followed by reaction with anti-β-catenin and anti-Pitx2 antibodies (Santa Cruz Biotechnologies, Santa Cruz, CA) for 1 h. Sections were incubated sequentially with peroxidase-conjugated secondary antibodies (Upstate, Lake Placid, NY) and visualized with Chemmate envision detection kit (Dako, Carpinteria, CA).
2.2 Cell culture
Hair follicles were isolated from scalp specimens according to the method previously reported [
]. Hair follicles were incubated with 0.25% trypsin, 0.02% ethylenediaminetetraacetic acid (EDTA) in PBS for 10 min. Hair follicles were then vigorously pipetted to obtain the single cell populations. The dissociated cells were rinsed in Dulbecco's modified Eagle's medium (DMEM) (HyClone, Logan, UT) supplemented with 10% fetal bovine serum (FBS) (Gibco, Grand Island, NY), and centrifuged for 5 min at 200 × g. ORS cells were then resuspended in keratinocyte-serum free medium (K-SFM) supplemented with epidermal growth factor (EGF) and bovine pituitary extract (Gibco), seeded onto culture dish. Cultures were maintained at 37 °C in a humidified atmosphere containing 5% CO2.
2.3 Cloning
Total RNA was isolated from cultured ORS cells using Easy-blue RNA extraction kit (Intron, Daejeon, Korea). Two micrograms of total RNA was reverse transcribed with moloney-murine leukaemia virus (M-MLV) reverse transcriptase (ELPIS biotech, Daejeon, Korea). Aliquot of RT mixture was subjected to PCR cycles with primer set for β-catenin (5′-CGCTACGGATCCATGGCTACTCAAGCTGATTT and 5′-CGCTACGGATCCTTACAGGTCAGTATCAAACC). The amplified full-length cDNA for β-catenin was subcloned into pENT/CMV vector that has attL sites for site-specific recombination with a Gateway destination vector (Invitrogen, Carlsbad, CA). For construction of 87-amino acid N-terminally truncated β-catenin (ΔN87βCat) expression vector, full-length cDNA for β-catenin was used as a template and following primers were used; 5′-CGCTACGGATCCTTACAGGTCAGTATCAAACC and 5′-CGCTACGGATCCTTACAGGTCAGTATCAAACC. For construction of pENT/TOPflash, the DNA fragment containing three copies of T-cell factor (TCF) binding site upstream of the thymidine kinase minimal promoter was amplified from TOPflash plasmid (kindly provided by Dr. Kwonseop Kim, Chonnam National University, Gwangju, Korea) with primers 5′-ATTCACGGTACCTATCATGTCTGGATCAGCC and 5′-ATTCACAAGCTTGGAGATCCTCTAGAGAGA. The amplified fragment was subcloned into pGL3Promoter vector (Promega, Madison, WI), then moved into pENT vector for Gateway cloning. For construction of K16-luc reporter vector, genomic DNA isolated from ORS cells were used as a template for PCR with primers 5′-GAGCTCAGGCAGAAGCAGG and 5′-AGGTGAGCGAGTGAGCAGTTG. Human Pitx2 full-length cDNA was amplified using primers 5′-GCAACCGGATCCATGAACTGCATGAAAGGCCC and 5′-GCCGCCGGATCCTCACACGGGCCGGTCCACTGC.
2.4 Creation of adenovirus
The replication-incompetent adenoviruses were created using Virapower adenovirus expression system (Invitrogen) according to the method previously described [
Sphingosylphosphorylcholine-induced interleukin-6 production is mediated by protein kinase C and p42/44 extracellular signal-regulated kinase in human dermal fibroblasts.
]. Briefly, site-specific recombination between entry vector and adenoviral destination vector was achieved by LR clonase (Invitrogen). The resulting adenoviral expression vector was then transfected into 293A cells using Lipofectamine 2000 (Invitrogen). Cells were grown until 80% cytopathic effect (CPE) was seen, then harvested for preparation of recombinant adenovirus.
2.5 Microarray analysis
After transduction of adenovirus expressing ΔN87βCat into ORS cells, total RNAs were isolated using a Tri reagent (Sigma, St. Louis, MO). The fluorescent labeled probes were prepared and applied to the 27 K human cDNA microarray slides (GenomicTree, Daejeon, Korea) as previously reported [
]. Microarray slides were analyzed using GenePix Pro 4.0 software (Axon Instruments, Union City, CA) and GeneSpring 7.2 software (Agilent Technologies, Redwood City, CA).
To evaluate the gene expression, 2 μg of total RNAs were reverse transcribed and then subjected to PCR cycles with specific primer sets. The primers used in the study are as follows; cyclophilin 5′-CTCCTTTGAGCTGTTTGCAG and 5′- CACCACATGCTTGCCATCCA, β-catenin 5′-TGCAGTTCGCCTTCACTATG and 5′-CTGCACAAACAATGGAATGG, keratin-16 5′-CTGAGACCTGGTTCCTGAGC and 5′-CGTCTTCACATCCAGCAAGA, keratin-17 5′-CAGTTCACCTCCTCCAGCTC and 5′-TCACCTCCAGCTCAGTGTTG, Pitx2 5′-CTCCTCATCTTCCTGTCACC and 5′-CCGAAGCCATTCTTGCATAGC.
2.7 Western blot analysis
Cells were lysed in RIPA buffer (150 mM NaCl, 50 mM Tris, pH 7.4, 1 mM EDTA, 0.1% NP-40 and 0.2 mM PMSF). After vigorous pipetting, extracts were centrifuged for 15 min at 13,000 rpm. Total protein was measured using a Bradford protein assay kit (Bio-Rad Laboratories, Hercules, CA). Samples were run on 10% SDS-polyacrylamide gels, transferred onto nitrocellulose membranes and incubated with appropriate antibodies for overnight at 4 °C with gentle agitation. Blots were then incubated with peroxidase-conjugated secondary antibodies for 1 h at room temperature, and visualized by enhanced chemiluminescence (Intron). Anti-keratin 16 and anti-keratin 17 antibodies were purchased from Santa Cruz Biotechnologies, anti-β-galactosidase antibody was obtained from ELPIS biotech, and anti-actin antibody was purchased from Sigma.
2.8 Luciferase assay
ORS cells were grown at 50% confluency in 12-well culture plate, then co-transduced with K16-luc reporter adenovirus and ΔN87βCat expressing adenovirus. After incubation for overnight, cells were replenished with fresh medium. Cells were further incubated for 48 h, and then cellular extracts were prepared using cell lysis buffer. Luciferase activities were determined using Luciferase assay system (Promega), according to the recommended protocol.
3. Results
3.1 Identification of β-catenin-regulated genes in ORS cells
Although it has been well established that stem cells reside in the bulge region of rodent hair follicle and β-catenin play a pivotal role to maintain their stem cell characteristics [
], the expression pattern of β-catenin in human hair follicle has not been well elucidated. To examine the expression of β-catenin in human hair follicle, scalp specimen was obtained from normal donor and analyzed by immunohistochemistry. The membranous expression of β-catenin was observed in almost all skin components including epidermis, sebaceous gland and hair follicle (Fig. 1A ). Interestingly, intense cytoplasmic staining of β-catenin was seen in the outmost ORS layer at putative bulge region of anagen hair follicle (upper inlet in Fig. 1A), while the expression of β-catenin in lower part of ORS was primarily confined in the membrane (lower inlet in Fig. 1A). These results implicate the importance of β-catenin in stem cell niche of human hair follicle tissue.
Fig. 1(A) Immunohistochemical staining of β-catenin. Paraffin section of scalp specimen was incubated with anti-β-catenin antibody, then sequentially incubated with HRP-conjugated secondary antibody. Intense cytoplasmic staining of β-catenin is observed in outer root sheath of putative bulge region (upper inlet). (B) Outer root sheath (ORS) cells were transduced with adenovirus expressing N-truncated β-catenin (ΔN87βCat) at 10 multiplicity of infection (MOI). The protein level for β-catenin was verified by Western blot. Upper band represents the endogenous β-catenin, while lower band represents the N-truncated β-catenin (arrow). Adenovirus expressing lacZ was used as negative control. (C) ORS cells were transduced with TOPflash adenovirus together with ΔN87βCat expressing adenovirus, then cells were lysed and assayed for luciferase activity. Data are represented as fold induction and SEM, measured from three independent experiments.
At amino terminus of β-catenin, there are several serine/threonine residues that are phosphorylated by casein kinase 1 (CK1) and glycogen synthase kinase-3β (GSK-3β), whose phosphorylation leads to the degradation of β-catenin [
]. Previous reports demonstrate that N-terminal truncation of β-catenin renders its constitutive stabilization in vivo as well as functioning as a transcription factor [
]. To express the constitutively stabilized β-catenin in hair cells, we made the recombinant adenovirus expressing N-terminal 87-amino acid truncated β-catenin (ΔN87βCat). After adenoviral transduction into ORS cells cultured in vitro, the expression of exogenously introduced gene was determined by Western blot analysis (Fig. 1B). When ORS cells were co-transduced with adenovirus expressing β-catenin-responsible reporter TOPflash, ΔN87βCat led to about 10-fold induction of luciferase activity, confirming the functionality of exogenously expressed β-catenin (Fig. 1C).
To identify the genes regulated by β-catenin in human ORS cells, we next performed cDNA microarray using total RNA isolated after adenoviral transduction (data not shown). As a result, we obtained several β-catenin-regulated genes, including hair cell differentiation markers keratin 16 and keratin 17. In addition, a bicoid-type homeodomain transcription factor Pitx2 was also identified as a β-catenin-regulated gene in ORS cells. To verify the cDNA microarray results, we transduced ORS cells with adenovirus expressing ΔN87βCat and performed RT-PCR and Western blot analyses. As shown in Fig. 2, overexpression of ΔN87βCat induced the expression of keratin 16, keratin 17 and Pitx2 at both mRNA and protein levels. These results implicate that β-catenin has a role for promoting follicular differentiation, and that Pitx2 acts as a downstream modulator of β-catenin in ORS cells.
Fig. 2(A) RT-PCR analysis of up-regulated gene by β-catenin in ORS cells. ORS cells were transduced with adenovirus expressing N-truncated β-catenin (ΔN87βCat) at 10 multiplicity of infection (MOI). Adenovirus expressing lacZ (Ad/lacZ) was used as negative control. Two micrograms of total RNAs were reverse transcribed with M-MLV reverse transcriptase and used for PCR amplification. Cyclophilin was used as an internal control. (B) The protein level for β-catenin-regulated genes was verified by Western blot. Arrow indicates the exogenously expressed N-truncated β-catenin.
3.2 Effect of Pitx2 on the expression of differentiation markers for follicular keratinocytes
To investigate whether Pitx2 affects the differentiation of ORS cells, we first examined the expression of Pitx2 in human hair follicle. As shown in Fig. 3, Pitx2 expression was detected in epidermis and hair follicle. Interestingly, Pitx2 expression was intense in lower part of ORS as compared with upper portion of hair follicle, suggesting the putative involvement of Pitx2 in the fate decision of stem cells to form follicular keratinocytes. To further investigate the role of Pitx2, we made the recombinant adenovirus expressing green fluorescent protein (GFP) tagged Pitx2. After adenoviral transduction into ORS cells cultured in vitro, the expression of Pitx2 was detected in the nucleus of ORS cells (Fig. 4A ). We then determined the effect of Pitx2 on the expression of differentiation markers for follicular keratinocytes by Western blot analysis. Overexpression of Pitx2 did not influence β-catenin expression, while the expression of keratin 16 and 17 was significantly increased by Pitx2. However, the expression of keratin 6, a type II keratin partner for keratin 16, was not increased significantly (Fig. 4B). To determine whether the Pitx2 effect was at the promoter level, we transduced ORS cells with K16-luc reporter adenovirus, in which about 1.7 kb of keratin 16 promoter fragment was fused to luciferase gene. As shown in Fig. 4C, overexpression of Pitx2 increased luciferase activity by about 5-fold, indicating that Pitx2 is a functional transcription factor directly involved in keratin 16 expression.
Fig. 3Immunohistochemical staining of Pitx2. Paraffin section of scalp specimen was incubated with anti-Pitx2 antibody, then sequentially incubated with HRP-conjugated secondary antibody. Intense expression of Pitx2 is detected in lower ORS part.
Fig. 4(A) Expression of exogenous Pitx2 in ORS cells. ORS cells were transduced with adenovirus expressing GFP-tagged Pitx2 (GFP-Pitx2) at 10 multiplicity of infection (MOI). Adenovirus expressing GFP was used as negative control. Twenty-four hours after adenoviral transduction, cells were observed under the fluorescent microscopy. (B) Effect of Pitx2 on the expression of differentiation markers for follicular keratinocytes. ORS cells were transduced with adenovirus expressing GFP-Pitx2 at the indicated MOI. Cellular extracts were prepared, and the protein level for differentiation markers for follicular keratinocytes was verified by Western blot. Actin was used as a loading control. (C) Effect of Pitx2 on the keratin 16 promoter activity. ORS cells were transduced with K16-luc reporter adenovirus together with Pitx2 expressing adenovirus. Cells were lysed and assayed for luciferase activity. Data are represented as fold induction and SEM, measured from three independent experiments.
Hair grows in a cyclical manner, characterized by a finite period of hair fiber production (anagen), a brief regression phase (catagen), and a resting period (telogen) [
]. This cyclic property of hair growth is largely dependent on the presence of stem cells in hair follicle tissue. Several outstanding works demonstrate that outer root sheath (ORS) keratinocytes located in the bulge have several properties consistent with their being the stem cells [
Cells within the bulge region of mouse hair follicle transiently proliferate during early anagen: heterogeneity and functional differences of various hair cycles.
]. During the telogen to anagen transition, a cluster of stem cells in bulge become activated to proliferate, then move downward. In this process, these cells are also committed to differentiate into follicular keratinocytes to form actively hair-producing follicle. Although the precise mechanism underlying the activation of bulge stem cells remains to be elucidated, it has been demonstrated that transient activation of β-catenin signaling is sufficient to trigger the active growth phase of hair cycle in mice [
In the present study, we overexpressed the stabilized β-catenin in ORS cells using adenovirus, and then performed cDNA microarray analysis. We obtained several β-catenin-regulated genes including the structural components of hair follicle, such as keratin 16 and keratin 17, as well as the transcription factor Pitx2. Previous study demonstrates that keratin 16 is expressed in the companion layer of the ORS during anagen stage [
]. It has been also reported that the expression of keratin 17 is increased around bulge region and consistently localized to keratinocytes at the advancing front of the emerging epithelial hair bulb during the anagen progression [
]. Thus, induction of keratin 16 and 17 expression reveals the differentiation of hair cells into follicular lineage. In this study, overexpression of β-catenin led to the induction of keratin 16 and 17 in cultured ORS cells, indicating that β-catenin has a role for promoting the follicular differentiation.
We identified Pitx 2, a bicoid-type homeodomain transcription factor as a downstream effector molecule of β-catenin in ORS cells. Pitx2 was originally identified as the candidate gene for Rieger syndrome, an autosomal dominant genetic disorder characterized by ocular, craniofacial and umbilical abnormalities as well as occasional defects in heart, limb, and pituitary [
]. In other systems, Pitx2 has been shown to be regulated by β-catenin. For instance, Wnt/Dvl/β-catenin signaling stimulates expression of Pitx2, which in turn can activate transcription of cyclin D2 and c-myc in cardiac outflow tract development [
]. Another example shows that Pitx2 acts as a downstream effector of β-catenin and critically involved in atrial separation during the cardiac morphogenesis [
]. Consistent with, in our study, overexpression of the stabilized β-catenin led to nice increase in Pitx2 expression in ORS cells cultured in vitro. Furthermore, Pitx2 induced the expression of keratin 16 and 17 in ORS cells, potentiating the notion that Pitx2 exerts its role as a positive regulator on the follicular differentiation. Despite the fact that Pitx2 is a downstream effector molecule of β-catenin in ORS cells, it is unlikely that Pitx2 is sufficient for anagen induction. As mentioned before, ORS cells in bulge region are activated at the telogen to anagen transition phase, then acquire a highly proliferative capability. In our preliminary experiment, however, overexpression of Pitx2 did not increase the proliferation of ORS cells cultured in vitro. Furthermore, intradermal injection of adenovirus expressing Pitx2 at the catagen stage (7-week-old C57BL/6 mice) failed to induce the catagen to anagen transition (data not shown). This result is somewhat consistent with the fact that the expression of Pitx2 is intense in lower part of ORS as compared with upper portion of hair follicle (Fig. 3). Precise regulation mechanism by which Pitx2 modulates the follicular differentiation should be investigated further.
In summary, our results suggest that Pitx2 is a functional downstream effector of β-catenin in ORS cells cultured in vitro and acts as a positive regulator for follicular differentiation.
Acknowledgments
This study was financially supported by research fund of Chungnam National University in 2006. Sohn KC, Jang S and Choi DK were supported by Brain Korea 21 Research Fellowship from the Korea Ministry of Education and Human Resources.
Sphingosylphosphorylcholine-induced interleukin-6 production is mediated by protein kinase C and p42/44 extracellular signal-regulated kinase in human dermal fibroblasts.
Cells within the bulge region of mouse hair follicle transiently proliferate during early anagen: heterogeneity and functional differences of various hair cycles.
00351-4&id=gr1.jpg){kind=link}
00351-4&id=gr2.jpg){kind=link}
00351-4&id=gr3.jpg){kind=link}
00351-4&id=gr4.jpg){kind=link}